Review



d5205 seqcap ez hybridization  (Zymo Research)


Bioz Verified Symbol Zymo Research is a verified supplier
Bioz Manufacturer Symbol Zymo Research manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99

    Structured Review

    Zymo Research d5205 seqcap ez hybridization
    D5205 Seqcap Ez Hybridization, supplied by Zymo Research, used in various techniques. Bioz Stars score: 99/100, based on 1504 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/d5205+seqcap+ez+hybridization/ChIP+DNA+Clean+%26+Concentrator/pmc06988126__mmc3-568-140-137
    Average 99 stars, based on 1504 article reviews
    d5205 seqcap ez hybridization - by Bioz Stars, 2026-09
    99/100 stars

    Images

    Related Articles

    Multiplex Assay:

    Article Title: Cohesin Disrupts Polycomb-Dependent Chromosome Interactions in Embryonic Stem Cells
    Article Snippet: EASY Pack Roche Cat# 05 892 970 001 Agencourt AMPure XP beads Beckman Coulter Cat# A63881 BSA-Molecular Biology Grade (20 mg/ml) NEB Cat# B9000S 1-4-Dithiothreitol Roth Cat# 6908.1 (Continued on next page) e1 Cell Reports 30, 820–835.e1–e10, January 21, 2020 .. REAGENT or RESOURCE SOURCE IDENTIFIER Critical Commercial Assays NEBNext Multiplex Oligos for Illumina (Index Primers Set 1) NEB Cat# E7335L NEBNext Multiplex Oligos for Illumina (Index Primers Set 2) NEB Cat# E7500L NEBNext Ultra DNA Library Prep Kit for Illumina NEB Cat# E7370L NEBNext Ultra II Directional RNA Library Prep Kit for Illumina NEB Cat# E7760L NEBNext Ultra II FS DNA Library Prep Kit for Illumina NEB Cat# E7805L NEBNext rRNA Depletion Kit (HumanMouseRat) NEB Cat# E6310L High Sensitivity DNA Kit for Bioanalyzer Agilent Cat# 5067-4626 RNA Pico 6000 Kit for Bioanalyzer Agilent Cat# 5067-1513 TURBO DNA-free Kit Thermo Fisher Scientific Cat# AM1907 NextSeq 500/550 High Output Kit v2 (150 cycles) Illumina Cat# FC-404-2002 NextSeq 500/550 High Output v2 Kit (75 cycles) Illumina Cat# FC-404-2005 KAPA Illumina DNA Standards Roche Cat# 7960387001 ChIP DNA Clean and Concentrator Zymo Research Cat# D5205 SeqCap EZ Hybridization and Wash Kit Roche (Nimblegen) Cat# 5634261001 SeqCap EZ Accessory Kit v2 Roche (Nimblegen) Cat# 07145594001 SeqCap EZ HE-Oligo Kit A Roche (Nimblegen) Cat# 6777287001 SeqCap EZ HE-Oligo Kit B Roche (Nimblegen) Cat# 6777317001 NEBNext End Repair Module NEB Cat# E6050L NEBNext dA-Tailing Module NEB Cat# E6053L NEBNext Quick Ligation Module NEB Cat# E6056L Dynabeads M-270 Streptavidin Thermo Fisher Scientific Cat# 65306 Herculase II Fusion DNA Polymerases Agilent Cat# 600677 illustra G-50 microspin columns GE Healthcare Cat# 27533002 NEBNext Q5 Hot Start HiFi PCR Master Mix NEB Cat# M0543L Deposited Data Capture-C This study ArrayExpress: E-MTAB-7840 calibrated ChIP-Seq This study ArrayExpress: E-MTAB-7817 calibrated RNA-Seq This study ArrayExpress: E-MTAB-7818 Hi-C This study ArrayExpress: E-MTAB-7816 Experimental Models: Cell Lines Mouse ESC: Scc1-mAID-eGFP This study N/A Mouse ESC: AID-Ring1b;Ring1a / This study N/A Mouse ESC: Scc1-mAID-eGFP;Ring1b-AID;Ring1a / This study N/A Mouse ESC: Ctcf.-AID Nora et al., 2017 N/A Mouse ESC: Scc1-mAID-eGFP;Pcgf2-HaloTag This study N/A Oligonucleotides CaptureC probes This study See Table S2 gRNA ROSA26 CGCCCATCTTCTAGAAAGAC This study N/A gRNA SCC1 30 CCACGGTTCCATATTATCTG This study N/A gRNA RING1A 50UTR CTCAGCGGAGCCCCGCTTGG This study N/A gRNA RING1A Intron 3 GCGACCGTGCAGCTGACGTT This study N/A gRNA RING1B 50 GCACAGCCTGAGACATTTCT This study N/A gRNA PCGF2 30 CCCTTTCCTCAAGGGGGGCA This study N/A (Continued on next page) Cell Reports 30, 820–835.e1–e10, January 21, 2020 e2 ..

    Chromatin Immunoprecipitation:

    Article Title: Cohesin Disrupts Polycomb-Dependent Chromosome Interactions in Embryonic Stem Cells
    Article Snippet: EASY Pack Roche Cat# 05 892 970 001 Agencourt AMPure XP beads Beckman Coulter Cat# A63881 BSA-Molecular Biology Grade (20 mg/ml) NEB Cat# B9000S 1-4-Dithiothreitol Roth Cat# 6908.1 (Continued on next page) e1 Cell Reports 30, 820–835.e1–e10, January 21, 2020 .. REAGENT or RESOURCE SOURCE IDENTIFIER Critical Commercial Assays NEBNext Multiplex Oligos for Illumina (Index Primers Set 1) NEB Cat# E7335L NEBNext Multiplex Oligos for Illumina (Index Primers Set 2) NEB Cat# E7500L NEBNext Ultra DNA Library Prep Kit for Illumina NEB Cat# E7370L NEBNext Ultra II Directional RNA Library Prep Kit for Illumina NEB Cat# E7760L NEBNext Ultra II FS DNA Library Prep Kit for Illumina NEB Cat# E7805L NEBNext rRNA Depletion Kit (HumanMouseRat) NEB Cat# E6310L High Sensitivity DNA Kit for Bioanalyzer Agilent Cat# 5067-4626 RNA Pico 6000 Kit for Bioanalyzer Agilent Cat# 5067-1513 TURBO DNA-free Kit Thermo Fisher Scientific Cat# AM1907 NextSeq 500/550 High Output Kit v2 (150 cycles) Illumina Cat# FC-404-2002 NextSeq 500/550 High Output v2 Kit (75 cycles) Illumina Cat# FC-404-2005 KAPA Illumina DNA Standards Roche Cat# 7960387001 ChIP DNA Clean and Concentrator Zymo Research Cat# D5205 SeqCap EZ Hybridization and Wash Kit Roche (Nimblegen) Cat# 5634261001 SeqCap EZ Accessory Kit v2 Roche (Nimblegen) Cat# 07145594001 SeqCap EZ HE-Oligo Kit A Roche (Nimblegen) Cat# 6777287001 SeqCap EZ HE-Oligo Kit B Roche (Nimblegen) Cat# 6777317001 NEBNext End Repair Module NEB Cat# E6050L NEBNext dA-Tailing Module NEB Cat# E6053L NEBNext Quick Ligation Module NEB Cat# E6056L Dynabeads M-270 Streptavidin Thermo Fisher Scientific Cat# 65306 Herculase II Fusion DNA Polymerases Agilent Cat# 600677 illustra G-50 microspin columns GE Healthcare Cat# 27533002 NEBNext Q5 Hot Start HiFi PCR Master Mix NEB Cat# M0543L Deposited Data Capture-C This study ArrayExpress: E-MTAB-7840 calibrated ChIP-Seq This study ArrayExpress: E-MTAB-7817 calibrated RNA-Seq This study ArrayExpress: E-MTAB-7818 Hi-C This study ArrayExpress: E-MTAB-7816 Experimental Models: Cell Lines Mouse ESC: Scc1-mAID-eGFP This study N/A Mouse ESC: AID-Ring1b;Ring1a / This study N/A Mouse ESC: Scc1-mAID-eGFP;Ring1b-AID;Ring1a / This study N/A Mouse ESC: Ctcf.-AID Nora et al., 2017 N/A Mouse ESC: Scc1-mAID-eGFP;Pcgf2-HaloTag This study N/A Oligonucleotides CaptureC probes This study See Table S2 gRNA ROSA26 CGCCCATCTTCTAGAAAGAC This study N/A gRNA SCC1 30 CCACGGTTCCATATTATCTG This study N/A gRNA RING1A 50UTR CTCAGCGGAGCCCCGCTTGG This study N/A gRNA RING1A Intron 3 GCGACCGTGCAGCTGACGTT This study N/A gRNA RING1B 50 GCACAGCCTGAGACATTTCT This study N/A gRNA PCGF2 30 CCCTTTCCTCAAGGGGGGCA This study N/A (Continued on next page) Cell Reports 30, 820–835.e1–e10, January 21, 2020 e2 ..

    Hybridization:

    Article Title: Cohesin Disrupts Polycomb-Dependent Chromosome Interactions in Embryonic Stem Cells
    Article Snippet: EASY Pack Roche Cat# 05 892 970 001 Agencourt AMPure XP beads Beckman Coulter Cat# A63881 BSA-Molecular Biology Grade (20 mg/ml) NEB Cat# B9000S 1-4-Dithiothreitol Roth Cat# 6908.1 (Continued on next page) e1 Cell Reports 30, 820–835.e1–e10, January 21, 2020 .. REAGENT or RESOURCE SOURCE IDENTIFIER Critical Commercial Assays NEBNext Multiplex Oligos for Illumina (Index Primers Set 1) NEB Cat# E7335L NEBNext Multiplex Oligos for Illumina (Index Primers Set 2) NEB Cat# E7500L NEBNext Ultra DNA Library Prep Kit for Illumina NEB Cat# E7370L NEBNext Ultra II Directional RNA Library Prep Kit for Illumina NEB Cat# E7760L NEBNext Ultra II FS DNA Library Prep Kit for Illumina NEB Cat# E7805L NEBNext rRNA Depletion Kit (HumanMouseRat) NEB Cat# E6310L High Sensitivity DNA Kit for Bioanalyzer Agilent Cat# 5067-4626 RNA Pico 6000 Kit for Bioanalyzer Agilent Cat# 5067-1513 TURBO DNA-free Kit Thermo Fisher Scientific Cat# AM1907 NextSeq 500/550 High Output Kit v2 (150 cycles) Illumina Cat# FC-404-2002 NextSeq 500/550 High Output v2 Kit (75 cycles) Illumina Cat# FC-404-2005 KAPA Illumina DNA Standards Roche Cat# 7960387001 ChIP DNA Clean and Concentrator Zymo Research Cat# D5205 SeqCap EZ Hybridization and Wash Kit Roche (Nimblegen) Cat# 5634261001 SeqCap EZ Accessory Kit v2 Roche (Nimblegen) Cat# 07145594001 SeqCap EZ HE-Oligo Kit A Roche (Nimblegen) Cat# 6777287001 SeqCap EZ HE-Oligo Kit B Roche (Nimblegen) Cat# 6777317001 NEBNext End Repair Module NEB Cat# E6050L NEBNext dA-Tailing Module NEB Cat# E6053L NEBNext Quick Ligation Module NEB Cat# E6056L Dynabeads M-270 Streptavidin Thermo Fisher Scientific Cat# 65306 Herculase II Fusion DNA Polymerases Agilent Cat# 600677 illustra G-50 microspin columns GE Healthcare Cat# 27533002 NEBNext Q5 Hot Start HiFi PCR Master Mix NEB Cat# M0543L Deposited Data Capture-C This study ArrayExpress: E-MTAB-7840 calibrated ChIP-Seq This study ArrayExpress: E-MTAB-7817 calibrated RNA-Seq This study ArrayExpress: E-MTAB-7818 Hi-C This study ArrayExpress: E-MTAB-7816 Experimental Models: Cell Lines Mouse ESC: Scc1-mAID-eGFP This study N/A Mouse ESC: AID-Ring1b;Ring1a / This study N/A Mouse ESC: Scc1-mAID-eGFP;Ring1b-AID;Ring1a / This study N/A Mouse ESC: Ctcf.-AID Nora et al., 2017 N/A Mouse ESC: Scc1-mAID-eGFP;Pcgf2-HaloTag This study N/A Oligonucleotides CaptureC probes This study See Table S2 gRNA ROSA26 CGCCCATCTTCTAGAAAGAC This study N/A gRNA SCC1 30 CCACGGTTCCATATTATCTG This study N/A gRNA RING1A 50UTR CTCAGCGGAGCCCCGCTTGG This study N/A gRNA RING1A Intron 3 GCGACCGTGCAGCTGACGTT This study N/A gRNA RING1B 50 GCACAGCCTGAGACATTTCT This study N/A gRNA PCGF2 30 CCCTTTCCTCAAGGGGGGCA This study N/A (Continued on next page) Cell Reports 30, 820–835.e1–e10, January 21, 2020 e2 ..

    Ligation:

    Article Title: Cohesin Disrupts Polycomb-Dependent Chromosome Interactions in Embryonic Stem Cells
    Article Snippet: EASY Pack Roche Cat# 05 892 970 001 Agencourt AMPure XP beads Beckman Coulter Cat# A63881 BSA-Molecular Biology Grade (20 mg/ml) NEB Cat# B9000S 1-4-Dithiothreitol Roth Cat# 6908.1 (Continued on next page) e1 Cell Reports 30, 820–835.e1–e10, January 21, 2020 .. REAGENT or RESOURCE SOURCE IDENTIFIER Critical Commercial Assays NEBNext Multiplex Oligos for Illumina (Index Primers Set 1) NEB Cat# E7335L NEBNext Multiplex Oligos for Illumina (Index Primers Set 2) NEB Cat# E7500L NEBNext Ultra DNA Library Prep Kit for Illumina NEB Cat# E7370L NEBNext Ultra II Directional RNA Library Prep Kit for Illumina NEB Cat# E7760L NEBNext Ultra II FS DNA Library Prep Kit for Illumina NEB Cat# E7805L NEBNext rRNA Depletion Kit (HumanMouseRat) NEB Cat# E6310L High Sensitivity DNA Kit for Bioanalyzer Agilent Cat# 5067-4626 RNA Pico 6000 Kit for Bioanalyzer Agilent Cat# 5067-1513 TURBO DNA-free Kit Thermo Fisher Scientific Cat# AM1907 NextSeq 500/550 High Output Kit v2 (150 cycles) Illumina Cat# FC-404-2002 NextSeq 500/550 High Output v2 Kit (75 cycles) Illumina Cat# FC-404-2005 KAPA Illumina DNA Standards Roche Cat# 7960387001 ChIP DNA Clean and Concentrator Zymo Research Cat# D5205 SeqCap EZ Hybridization and Wash Kit Roche (Nimblegen) Cat# 5634261001 SeqCap EZ Accessory Kit v2 Roche (Nimblegen) Cat# 07145594001 SeqCap EZ HE-Oligo Kit A Roche (Nimblegen) Cat# 6777287001 SeqCap EZ HE-Oligo Kit B Roche (Nimblegen) Cat# 6777317001 NEBNext End Repair Module NEB Cat# E6050L NEBNext dA-Tailing Module NEB Cat# E6053L NEBNext Quick Ligation Module NEB Cat# E6056L Dynabeads M-270 Streptavidin Thermo Fisher Scientific Cat# 65306 Herculase II Fusion DNA Polymerases Agilent Cat# 600677 illustra G-50 microspin columns GE Healthcare Cat# 27533002 NEBNext Q5 Hot Start HiFi PCR Master Mix NEB Cat# M0543L Deposited Data Capture-C This study ArrayExpress: E-MTAB-7840 calibrated ChIP-Seq This study ArrayExpress: E-MTAB-7817 calibrated RNA-Seq This study ArrayExpress: E-MTAB-7818 Hi-C This study ArrayExpress: E-MTAB-7816 Experimental Models: Cell Lines Mouse ESC: Scc1-mAID-eGFP This study N/A Mouse ESC: AID-Ring1b;Ring1a / This study N/A Mouse ESC: Scc1-mAID-eGFP;Ring1b-AID;Ring1a / This study N/A Mouse ESC: Ctcf.-AID Nora et al., 2017 N/A Mouse ESC: Scc1-mAID-eGFP;Pcgf2-HaloTag This study N/A Oligonucleotides CaptureC probes This study See Table S2 gRNA ROSA26 CGCCCATCTTCTAGAAAGAC This study N/A gRNA SCC1 30 CCACGGTTCCATATTATCTG This study N/A gRNA RING1A 50UTR CTCAGCGGAGCCCCGCTTGG This study N/A gRNA RING1A Intron 3 GCGACCGTGCAGCTGACGTT This study N/A gRNA RING1B 50 GCACAGCCTGAGACATTTCT This study N/A gRNA PCGF2 30 CCCTTTCCTCAAGGGGGGCA This study N/A (Continued on next page) Cell Reports 30, 820–835.e1–e10, January 21, 2020 e2 ..

    Polymerase Chain Reaction:

    Article Title: Cohesin Disrupts Polycomb-Dependent Chromosome Interactions in Embryonic Stem Cells
    Article Snippet: EASY Pack Roche Cat# 05 892 970 001 Agencourt AMPure XP beads Beckman Coulter Cat# A63881 BSA-Molecular Biology Grade (20 mg/ml) NEB Cat# B9000S 1-4-Dithiothreitol Roth Cat# 6908.1 (Continued on next page) e1 Cell Reports 30, 820–835.e1–e10, January 21, 2020 .. REAGENT or RESOURCE SOURCE IDENTIFIER Critical Commercial Assays NEBNext Multiplex Oligos for Illumina (Index Primers Set 1) NEB Cat# E7335L NEBNext Multiplex Oligos for Illumina (Index Primers Set 2) NEB Cat# E7500L NEBNext Ultra DNA Library Prep Kit for Illumina NEB Cat# E7370L NEBNext Ultra II Directional RNA Library Prep Kit for Illumina NEB Cat# E7760L NEBNext Ultra II FS DNA Library Prep Kit for Illumina NEB Cat# E7805L NEBNext rRNA Depletion Kit (HumanMouseRat) NEB Cat# E6310L High Sensitivity DNA Kit for Bioanalyzer Agilent Cat# 5067-4626 RNA Pico 6000 Kit for Bioanalyzer Agilent Cat# 5067-1513 TURBO DNA-free Kit Thermo Fisher Scientific Cat# AM1907 NextSeq 500/550 High Output Kit v2 (150 cycles) Illumina Cat# FC-404-2002 NextSeq 500/550 High Output v2 Kit (75 cycles) Illumina Cat# FC-404-2005 KAPA Illumina DNA Standards Roche Cat# 7960387001 ChIP DNA Clean and Concentrator Zymo Research Cat# D5205 SeqCap EZ Hybridization and Wash Kit Roche (Nimblegen) Cat# 5634261001 SeqCap EZ Accessory Kit v2 Roche (Nimblegen) Cat# 07145594001 SeqCap EZ HE-Oligo Kit A Roche (Nimblegen) Cat# 6777287001 SeqCap EZ HE-Oligo Kit B Roche (Nimblegen) Cat# 6777317001 NEBNext End Repair Module NEB Cat# E6050L NEBNext dA-Tailing Module NEB Cat# E6053L NEBNext Quick Ligation Module NEB Cat# E6056L Dynabeads M-270 Streptavidin Thermo Fisher Scientific Cat# 65306 Herculase II Fusion DNA Polymerases Agilent Cat# 600677 illustra G-50 microspin columns GE Healthcare Cat# 27533002 NEBNext Q5 Hot Start HiFi PCR Master Mix NEB Cat# M0543L Deposited Data Capture-C This study ArrayExpress: E-MTAB-7840 calibrated ChIP-Seq This study ArrayExpress: E-MTAB-7817 calibrated RNA-Seq This study ArrayExpress: E-MTAB-7818 Hi-C This study ArrayExpress: E-MTAB-7816 Experimental Models: Cell Lines Mouse ESC: Scc1-mAID-eGFP This study N/A Mouse ESC: AID-Ring1b;Ring1a / This study N/A Mouse ESC: Scc1-mAID-eGFP;Ring1b-AID;Ring1a / This study N/A Mouse ESC: Ctcf.-AID Nora et al., 2017 N/A Mouse ESC: Scc1-mAID-eGFP;Pcgf2-HaloTag This study N/A Oligonucleotides CaptureC probes This study See Table S2 gRNA ROSA26 CGCCCATCTTCTAGAAAGAC This study N/A gRNA SCC1 30 CCACGGTTCCATATTATCTG This study N/A gRNA RING1A 50UTR CTCAGCGGAGCCCCGCTTGG This study N/A gRNA RING1A Intron 3 GCGACCGTGCAGCTGACGTT This study N/A gRNA RING1B 50 GCACAGCCTGAGACATTTCT This study N/A gRNA PCGF2 30 CCCTTTCCTCAAGGGGGGCA This study N/A (Continued on next page) Cell Reports 30, 820–835.e1–e10, January 21, 2020 e2 ..

    Capture-C:

    Article Title: Cohesin Disrupts Polycomb-Dependent Chromosome Interactions in Embryonic Stem Cells
    Article Snippet: EASY Pack Roche Cat# 05 892 970 001 Agencourt AMPure XP beads Beckman Coulter Cat# A63881 BSA-Molecular Biology Grade (20 mg/ml) NEB Cat# B9000S 1-4-Dithiothreitol Roth Cat# 6908.1 (Continued on next page) e1 Cell Reports 30, 820–835.e1–e10, January 21, 2020 .. REAGENT or RESOURCE SOURCE IDENTIFIER Critical Commercial Assays NEBNext Multiplex Oligos for Illumina (Index Primers Set 1) NEB Cat# E7335L NEBNext Multiplex Oligos for Illumina (Index Primers Set 2) NEB Cat# E7500L NEBNext Ultra DNA Library Prep Kit for Illumina NEB Cat# E7370L NEBNext Ultra II Directional RNA Library Prep Kit for Illumina NEB Cat# E7760L NEBNext Ultra II FS DNA Library Prep Kit for Illumina NEB Cat# E7805L NEBNext rRNA Depletion Kit (HumanMouseRat) NEB Cat# E6310L High Sensitivity DNA Kit for Bioanalyzer Agilent Cat# 5067-4626 RNA Pico 6000 Kit for Bioanalyzer Agilent Cat# 5067-1513 TURBO DNA-free Kit Thermo Fisher Scientific Cat# AM1907 NextSeq 500/550 High Output Kit v2 (150 cycles) Illumina Cat# FC-404-2002 NextSeq 500/550 High Output v2 Kit (75 cycles) Illumina Cat# FC-404-2005 KAPA Illumina DNA Standards Roche Cat# 7960387001 ChIP DNA Clean and Concentrator Zymo Research Cat# D5205 SeqCap EZ Hybridization and Wash Kit Roche (Nimblegen) Cat# 5634261001 SeqCap EZ Accessory Kit v2 Roche (Nimblegen) Cat# 07145594001 SeqCap EZ HE-Oligo Kit A Roche (Nimblegen) Cat# 6777287001 SeqCap EZ HE-Oligo Kit B Roche (Nimblegen) Cat# 6777317001 NEBNext End Repair Module NEB Cat# E6050L NEBNext dA-Tailing Module NEB Cat# E6053L NEBNext Quick Ligation Module NEB Cat# E6056L Dynabeads M-270 Streptavidin Thermo Fisher Scientific Cat# 65306 Herculase II Fusion DNA Polymerases Agilent Cat# 600677 illustra G-50 microspin columns GE Healthcare Cat# 27533002 NEBNext Q5 Hot Start HiFi PCR Master Mix NEB Cat# M0543L Deposited Data Capture-C This study ArrayExpress: E-MTAB-7840 calibrated ChIP-Seq This study ArrayExpress: E-MTAB-7817 calibrated RNA-Seq This study ArrayExpress: E-MTAB-7818 Hi-C This study ArrayExpress: E-MTAB-7816 Experimental Models: Cell Lines Mouse ESC: Scc1-mAID-eGFP This study N/A Mouse ESC: AID-Ring1b;Ring1a / This study N/A Mouse ESC: Scc1-mAID-eGFP;Ring1b-AID;Ring1a / This study N/A Mouse ESC: Ctcf.-AID Nora et al., 2017 N/A Mouse ESC: Scc1-mAID-eGFP;Pcgf2-HaloTag This study N/A Oligonucleotides CaptureC probes This study See Table S2 gRNA ROSA26 CGCCCATCTTCTAGAAAGAC This study N/A gRNA SCC1 30 CCACGGTTCCATATTATCTG This study N/A gRNA RING1A 50UTR CTCAGCGGAGCCCCGCTTGG This study N/A gRNA RING1A Intron 3 GCGACCGTGCAGCTGACGTT This study N/A gRNA RING1B 50 GCACAGCCTGAGACATTTCT This study N/A gRNA PCGF2 30 CCCTTTCCTCAAGGGGGGCA This study N/A (Continued on next page) Cell Reports 30, 820–835.e1–e10, January 21, 2020 e2 ..

    RNA sequencing:

    Article Title: Cohesin Disrupts Polycomb-Dependent Chromosome Interactions in Embryonic Stem Cells
    Article Snippet: EASY Pack Roche Cat# 05 892 970 001 Agencourt AMPure XP beads Beckman Coulter Cat# A63881 BSA-Molecular Biology Grade (20 mg/ml) NEB Cat# B9000S 1-4-Dithiothreitol Roth Cat# 6908.1 (Continued on next page) e1 Cell Reports 30, 820–835.e1–e10, January 21, 2020 .. REAGENT or RESOURCE SOURCE IDENTIFIER Critical Commercial Assays NEBNext Multiplex Oligos for Illumina (Index Primers Set 1) NEB Cat# E7335L NEBNext Multiplex Oligos for Illumina (Index Primers Set 2) NEB Cat# E7500L NEBNext Ultra DNA Library Prep Kit for Illumina NEB Cat# E7370L NEBNext Ultra II Directional RNA Library Prep Kit for Illumina NEB Cat# E7760L NEBNext Ultra II FS DNA Library Prep Kit for Illumina NEB Cat# E7805L NEBNext rRNA Depletion Kit (HumanMouseRat) NEB Cat# E6310L High Sensitivity DNA Kit for Bioanalyzer Agilent Cat# 5067-4626 RNA Pico 6000 Kit for Bioanalyzer Agilent Cat# 5067-1513 TURBO DNA-free Kit Thermo Fisher Scientific Cat# AM1907 NextSeq 500/550 High Output Kit v2 (150 cycles) Illumina Cat# FC-404-2002 NextSeq 500/550 High Output v2 Kit (75 cycles) Illumina Cat# FC-404-2005 KAPA Illumina DNA Standards Roche Cat# 7960387001 ChIP DNA Clean and Concentrator Zymo Research Cat# D5205 SeqCap EZ Hybridization and Wash Kit Roche (Nimblegen) Cat# 5634261001 SeqCap EZ Accessory Kit v2 Roche (Nimblegen) Cat# 07145594001 SeqCap EZ HE-Oligo Kit A Roche (Nimblegen) Cat# 6777287001 SeqCap EZ HE-Oligo Kit B Roche (Nimblegen) Cat# 6777317001 NEBNext End Repair Module NEB Cat# E6050L NEBNext dA-Tailing Module NEB Cat# E6053L NEBNext Quick Ligation Module NEB Cat# E6056L Dynabeads M-270 Streptavidin Thermo Fisher Scientific Cat# 65306 Herculase II Fusion DNA Polymerases Agilent Cat# 600677 illustra G-50 microspin columns GE Healthcare Cat# 27533002 NEBNext Q5 Hot Start HiFi PCR Master Mix NEB Cat# M0543L Deposited Data Capture-C This study ArrayExpress: E-MTAB-7840 calibrated ChIP-Seq This study ArrayExpress: E-MTAB-7817 calibrated RNA-Seq This study ArrayExpress: E-MTAB-7818 Hi-C This study ArrayExpress: E-MTAB-7816 Experimental Models: Cell Lines Mouse ESC: Scc1-mAID-eGFP This study N/A Mouse ESC: AID-Ring1b;Ring1a / This study N/A Mouse ESC: Scc1-mAID-eGFP;Ring1b-AID;Ring1a / This study N/A Mouse ESC: Ctcf.-AID Nora et al., 2017 N/A Mouse ESC: Scc1-mAID-eGFP;Pcgf2-HaloTag This study N/A Oligonucleotides CaptureC probes This study See Table S2 gRNA ROSA26 CGCCCATCTTCTAGAAAGAC This study N/A gRNA SCC1 30 CCACGGTTCCATATTATCTG This study N/A gRNA RING1A 50UTR CTCAGCGGAGCCCCGCTTGG This study N/A gRNA RING1A Intron 3 GCGACCGTGCAGCTGACGTT This study N/A gRNA RING1B 50 GCACAGCCTGAGACATTTCT This study N/A gRNA PCGF2 30 CCCTTTCCTCAAGGGGGGCA This study N/A (Continued on next page) Cell Reports 30, 820–835.e1–e10, January 21, 2020 e2 ..

    Hi-C:

    Article Title: Cohesin Disrupts Polycomb-Dependent Chromosome Interactions in Embryonic Stem Cells
    Article Snippet: EASY Pack Roche Cat# 05 892 970 001 Agencourt AMPure XP beads Beckman Coulter Cat# A63881 BSA-Molecular Biology Grade (20 mg/ml) NEB Cat# B9000S 1-4-Dithiothreitol Roth Cat# 6908.1 (Continued on next page) e1 Cell Reports 30, 820–835.e1–e10, January 21, 2020 .. REAGENT or RESOURCE SOURCE IDENTIFIER Critical Commercial Assays NEBNext Multiplex Oligos for Illumina (Index Primers Set 1) NEB Cat# E7335L NEBNext Multiplex Oligos for Illumina (Index Primers Set 2) NEB Cat# E7500L NEBNext Ultra DNA Library Prep Kit for Illumina NEB Cat# E7370L NEBNext Ultra II Directional RNA Library Prep Kit for Illumina NEB Cat# E7760L NEBNext Ultra II FS DNA Library Prep Kit for Illumina NEB Cat# E7805L NEBNext rRNA Depletion Kit (HumanMouseRat) NEB Cat# E6310L High Sensitivity DNA Kit for Bioanalyzer Agilent Cat# 5067-4626 RNA Pico 6000 Kit for Bioanalyzer Agilent Cat# 5067-1513 TURBO DNA-free Kit Thermo Fisher Scientific Cat# AM1907 NextSeq 500/550 High Output Kit v2 (150 cycles) Illumina Cat# FC-404-2002 NextSeq 500/550 High Output v2 Kit (75 cycles) Illumina Cat# FC-404-2005 KAPA Illumina DNA Standards Roche Cat# 7960387001 ChIP DNA Clean and Concentrator Zymo Research Cat# D5205 SeqCap EZ Hybridization and Wash Kit Roche (Nimblegen) Cat# 5634261001 SeqCap EZ Accessory Kit v2 Roche (Nimblegen) Cat# 07145594001 SeqCap EZ HE-Oligo Kit A Roche (Nimblegen) Cat# 6777287001 SeqCap EZ HE-Oligo Kit B Roche (Nimblegen) Cat# 6777317001 NEBNext End Repair Module NEB Cat# E6050L NEBNext dA-Tailing Module NEB Cat# E6053L NEBNext Quick Ligation Module NEB Cat# E6056L Dynabeads M-270 Streptavidin Thermo Fisher Scientific Cat# 65306 Herculase II Fusion DNA Polymerases Agilent Cat# 600677 illustra G-50 microspin columns GE Healthcare Cat# 27533002 NEBNext Q5 Hot Start HiFi PCR Master Mix NEB Cat# M0543L Deposited Data Capture-C This study ArrayExpress: E-MTAB-7840 calibrated ChIP-Seq This study ArrayExpress: E-MTAB-7817 calibrated RNA-Seq This study ArrayExpress: E-MTAB-7818 Hi-C This study ArrayExpress: E-MTAB-7816 Experimental Models: Cell Lines Mouse ESC: Scc1-mAID-eGFP This study N/A Mouse ESC: AID-Ring1b;Ring1a / This study N/A Mouse ESC: Scc1-mAID-eGFP;Ring1b-AID;Ring1a / This study N/A Mouse ESC: Ctcf.-AID Nora et al., 2017 N/A Mouse ESC: Scc1-mAID-eGFP;Pcgf2-HaloTag This study N/A Oligonucleotides CaptureC probes This study See Table S2 gRNA ROSA26 CGCCCATCTTCTAGAAAGAC This study N/A gRNA SCC1 30 CCACGGTTCCATATTATCTG This study N/A gRNA RING1A 50UTR CTCAGCGGAGCCCCGCTTGG This study N/A gRNA RING1A Intron 3 GCGACCGTGCAGCTGACGTT This study N/A gRNA RING1B 50 GCACAGCCTGAGACATTTCT This study N/A gRNA PCGF2 30 CCCTTTCCTCAAGGGGGGCA This study N/A (Continued on next page) Cell Reports 30, 820–835.e1–e10, January 21, 2020 e2 ..



    Similar Products

    99
    Zymo Research d5205 seqcap ez hybridization
    D5205 Seqcap Ez Hybridization, supplied by Zymo Research, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/d5205+seqcap+ez+hybridization/ChIP+DNA+Clean+%26+Concentrator/pmc06988126__mmc3-568-140-137
    Average 99 stars, based on 1 article reviews
    d5205 seqcap ez hybridization - by Bioz Stars, 2026-09
    99/100 stars
      Buy from Supplier

    Image Search Results